Week 4 News and Notes
Who Can Resist The Allure Of Family Day?
Inspired by the success of the Denim Demons’ Family Day in 2009, this past Sunday marked the first ever league-wide Family Day. League manager Adriano “Muscles Marinara” Bratta encouraged all league members to invite their families and friends, and also to prepare a cherished food item.
Although the event was met with mild success, there were still several league members who participated. Amy Kovner of the Gouging Anklebiters brought chocolate-covered strawberries (STRAWBERRIES? AAAHHH!!!) and her husband, Mr. Kovner (Todd). Anklebiters captain Phil “Sandy” Donohue shared cupcakes from Sugar Sweet Sunshine bakery, which thankfully did not find their way into any of Minkus’ crevices. Jason Eitel of the Corlears Hookers forced his girlfriend to cook homemade empenadas with salsa, which he then noted were made by a real Colombian (unlike Eitel, who is neither Colombian nor Canadian). Bratta’s mother even made a brief cameo to serve her world famous tiramisu.
Mike Sokolyansky of Fresh Kills brought his brother Dave, who scored a goal, but did not cook.
Dirty Laundry
Written by Fashion Correspondent Abigail Meisterman
“People change, hairstyles change, interest rates fluctuate.” – Hillary Flammond, Top Secret
In concurrence with the unemployment rate, BTSH’s numbers have swelled. This is not to say there is any causation or correlation (although people on funemployment may find hockey as a good way to take out their jobless frustrations), just that each has gotten larger. Since a cap on active rosters has been put in place, new teams have formed so that all may play. And with new teams, as well as old, come new jerseys.
This week, let’s look at Poutine Machine, a brand new team filled with old players — old as in veteran, not age. Of course, I’m assuming that, since captain Patrick “Sven” Larsen preferred not to disclose the birth dates, social security numbers, and bank pins of his players. In a short e-mail conversation with Larsen, I gleaned the name source of the MacNeil Division’s tribute to Quebec’s Nordiques. On a romantic getaway to Ottawa, Larsen and his fiancée, Filthy Gorgeous captain Monica Russo, were looking for some afternoon delight and came upon a shack that served up the Canadian delight (which is very, very different from Turkish Delight).
From there, it was just a matter of brainstorming with Canadian, graphic designer, and team member (triple threat!) Kevin Macdonald to find a logo that would express PM’s love of all things Canadian*, which according to Larsen is really just poutine and hockey. I would like to submit the following for further consideration to receive love: Canadian Sex Acts (no pics, only text).
They say imitation is the highest form of flattery, so Macdonald must be pretty high. The shirts are very well done and anyone who has any knowledge of hockey/NHL pre-1995 (which I don’t, except for what I learned while writing this) will no doubt rejoice in their Nordiques tribute. What do I think? Well, I just hope that the blue brings out Marcus Bonnee’s eyes.
* All things Canada? Does this mean they love the Crash Test Dummies who have a new album out next week?
A Special Thank You From “Con” Ed Lau
After another successful American Cancer Society tournament, “Con” Ed Lau wishes to thank everyone who supported the cause. This includes those who helped to run and organize the event, as well as those who donated and played. More than $4,200 was raised this year, which is the best single year total in tournament history. Ed is looking forward to running the event again next year.
Know Your Neighbor
Name: Chadwick
Team: Happy Little Elves
Nickname: The Chairman
Reason For Nickname: This picture of him holding a chair
Rejected Nicknames: The Professor, Hockey Bitch, Chad-Trick
Origin: Washington, DC
College: University of North America
Early Aspirations: To headline a Friday Night Live concert on the Town Green with his band The Hanging Chads
First Job: Mascot for Green Giant
Current Job: Financial Something Or Other
Hero: Alex Ovechkin
Reason to Love Him: Without his assistance, your humble correspondents would not be able to use bullet points on this website.
Reason to Hate Him: The Elves’ Personnel Purge of ’09
Fast Fact: Chadwick’s “Eggs Benedict” came in second place in his hometown’s annual Taste of the Town in 1995. The winner was future Mathematic Justin Perras of Vienna, VA for his homemade jambalaya.
Favorite Things: Rich Glanzer, the Elves’ blackout jersey, the Washington Capitals, viscous prose
Favorite BTSH Traveling Trophy: The Barnacle Bowl
Least Favorite Things: Rich Glanzer, Henrik Lundqvist, Dulles International Airport, brevity
Best Known For: Looking down on everyone else
Things the Media Will Continue to Overhype about Him: With Rich Glanzer handling the Elves’ personnel decisions, Chadwick is no more than a figurehead captain.
Hockey Comparison: Zdeno Chara
Non-Hockey Comparison: The Queen of England
Down the Road: Upon retirement from BTSH, Chadwick attempts to write the great American novel. However, his book publisher passes on his weighty and pedantic treatise, opting instead for a children’s book written by 999 monkeys and one Eric “El Guapo” DiPierri at 1,000 typewriters.
Tags: 2010 season, ACS Tournament, Gouging Anklebiters, Happy Little Elves, news and notes, Poutine Machine



Ben is absolutely not a “figurehead” captain. He just has other responsibilities. Though I miss his great acquisitions of the Barnicle and Marc “I need my touches like Randy Moss” Surchin, I have to settle for Trevor, Ryan and O’Neil. All five are very similar players.
First of all, I love Dulles Airport, Eero Saarinen’s masterpiece of modernism. Secondly, I am officially boycotting the ‘Eli Grocery’! Lastly, Derek promised me this awful photo was strictly for his private use, and he paid me $50 to open that last button.
I realized after we posted that we forgot to put Ben’s social security number in the profile, so for those interested, it’s 113-34-4597.
Only $50? You’re such a bargain.
Derek, you also forgot to post my DNA sample. Here it is: GATGTGAGACCAACAGATGAGGGTAATGGACAGCAGGCAGCGGAGTGACGAGGATGGACGAG
CACAGGATTACATGAGTAGGCCACGTGACTACGTACGTATTCATTCTGAGCTATCGACTACT
Interestingly, they found the exact same strand in Manute Bol and Bill O’Reilly.
GATTACA! GATTACA!
CAT GAG TAG!
When I make my Willis Reed like return, I’m hoping the C in Rich stands for Chadtrick.
Tell us more about this Chadtrick, Rich. I know not of what you speak.
If you do not know of what this extremely rare and thought non existent chadtrick is you are a feeble mind turd. Hey i had a lot to write i need every single monkey. But i did not allow them to unionize, much too costly
Yikes! First, Hockey Rich and The Chairman. Now Guapo?
The Elves have taken over!!!!!!!!!! Sarah T. where are you?!?!?!?
Between the goal scoring honor, the frightening profile, my imminent victory in Survivor Pool, and the fixes I made to the website, I think it’s time we just rename the league in my honor… From now on, BTSH shall be known as “The Dr. Byron Clavicle Weekly Street Hockey Extravaganza!” (DBCWSHE). Actually, I think I’ll piss everyone off and name it “Glanzerama’s World of Sport!”
“Glanzerama’s World of Sport” implies other athletic endeavors. What, pray tell, will we be playing in addition to hockey?
Did somebody say my name?
PS- Ben Chadwick rules. Elves 4-eva!
While I’m at it, I think I’ll rename the website to “The Elves Electric Love-In (with special guests Abby and Derek)”.
Ben, why is the color of this website Squirells brown? The Squirells are dead, lime green it up!!
Indeed. Go Green!!! can we get a couple coronas with the lime??
I think we broke Derek and Eli!!
[…] of the new teams strive to make an impression with a creative take on a recognizable logo (e.g. Poutine Machine) or their own design, while older teams have decided not to reinvent the wheel and just update […]